Frequently Asked Questions
Sample Submission
- How do I submit samples to YCGA?
Please request a sequencing account using the link below. Once your account is approved you will be able to access the sample submission form. Samples and the completed form can be brought to YCGA (830 West Campus Drive, West Haven) Mon-Fri 9am-5pm. We are closed in accordance with the University Holiday schedule
- How long does it take for a Wikilims account request to be approved?
Please allow for 1 business day for account approval.
- Are sample pickup locations available?
Yes, There is a -80 degree pickup located at 300 George St rm 2127. Pickup times are Tue and Thurs @ 9am. There is also a room temp pickup located at 300 Cedar St. (TAC), Room S352. Samples are picked up at 8 AM Mon and Wed.
Exome
- What is the difference between Exome Sequencing and Genome Sequencing?
Exome sequencing is a capture-based method that targets and sequences coding regions of the genome, referred as “the Exome”. Whole genome sequencing doesn’t require a capture step and offers coverage across the entire genome. While most of the interpretable data genome falls within the exome, genome sequencing is capable of detecting clinically relevant variations.
- What exome enrichment kit do you use?
For human samples, we use IDT xGen V2 chemistry. However, other kits can be procured upon request.
- How much coverage do I need?
The answer depends on the goals of your sequencing project. Several recommendations are shown below. Please feel free to contact us to discuss the right amount for your project.
Germline/frequent variants: 40-60X (~4-6 Gb)
Somatic/rare variants: =200x (20+ Gb)
Tumor vs Normal: =200x (20+ Gb) tumor, =100x (10+ Gb) normal
- How should I prepare and send my samples?
View our Project Submission Guidelines for instructions on preparing and sending your samples for exome or whole genome sequencing. Ship samples directly to our facility.
- When/where I can drop off my samples?
For Yale investigators there is a drop-off location at 300 George St., Room 2127 and at 300 Cedar St. (TAC), Room S352. Samples are picked up at 8 AM, Tuesdays and Thursdays from 300 George St. and Mondays, Wednesdays and Fridays from TAC. Please complete the WIKI sample submission form and place in a Ziploc bag along with your samples.
- What happens if my samples do not meet your starting material requirements?
Please feel free to contact us.
- What is the price for exome sequencing?
Please refer to our Service Fees.
Non-Yale investigators please request a quote.
- What is the turn-around time?
Current turn-around time is anticipated to be ~3-4 weeks, but may vary depending upon the complexity of the project and the volume of samples within the laboratory.
- In what format I will receive data?
We provide raw data as FASTQ files for all projects.
- Do you provide help with data analysis?
Please refer to Bioinformatics for help with data analysis.
- How long do you hold samples?
We store samples for one year upon project completion.
RNA-seq
- What kit should be used for extraction?
Any RNA isolation method or kit is acceptable to use provided that the final isolate is total RNA, intact, and free of contaminants, including DNA, excess salts, proteins, and RNAses. Total RNA is always run on the YCGA bioanlayzer prior to starting the library prep. When a sample is found to have low purity or integrity the user will be notified and asked if they would like either to continue or resubmit. Please note that YCGA is not responsible for poor data resulting from samples that did not pass initial qc but were approved for processing by the user.
- Should I select poly A or rRNA depletion for my library prep?
rRNA depletion efficiently removes the rRNA component of total RNA using a hybridization/bead capture procedure that selectively binds target sequences using biotinylated capture probes. The process minimizes ribosomal contamination and optimizes the percentage of reads covering RNA species. This library prep is ideal for partially degraded RNA or for sequencing non-polyadenylated transcripts (long non-coding). Poly A selection specifically selects/enriches for polyadenylated transcripts using oligo-dT beads followed by random priming. This process is ideal for samples that are not degraded (RIN > 7) and for sequencing applications that only require data from polyadenylated transcripts.
- How much RNA should be submitted?
Standard input poly A = > 200ng of total RNA in 15ul of RNase-free water.
Standard input rRNA depletion = > 200ng of total RNA in 15ul of RNase-free water.
smRNA enrichment = 200ng of total RNA in 15ul of RNase-free water.
Low-input preps require 200pg of total RNA.
- How many reads are required for RNA-seq?
Recommended number of reads (assuming H/M/R for species)
Prep Method Differential Gene Expression Splice Variants Poly A based rep 25M 80M rRNA Depletion 35M 100M - What is the cost for RNA-seq?
See pricing on the Service Fees page.
- Is a DNAse treatment required?
YCGA can perform the DNAse treatment and additional cleanups if necessary for a fee. This will increase the turnaround time for results and it is best if RNA arrives free of DNA and other contaminants.
User Prepared Libraries
- What information should I provide regarding my user prepared library?
Please provide the index sequences in an excel file with 3 columns. Column 1 (sample name), column 2 (I7 index), column 3 (I5 index). Please also let us know if custom primers are required and if the base diversity of the library is low.
- How should custom primers be submitted?
Custom primers should be HPLC purified and submitted at a concentration of 100uM. The primers should be clearly labeled with the Read or Index they correspond to as well as user/project identifying information. The NovaSeq requires 20ul/primer per run. We are currently using the reverse complement workflow for the NovaSeq, which may require custom index 2 (I5) primers for some libraries.
Sequencing
- Do I need to use the entire NovaSeq sequencing lane?
No, partial portions of a lane can be requested for the NovaSeq. You will only be charged for the amount of a lane you request. For MiSeq runs, partial lanes are not possible.
- Do I need to trim adapters?
YCGA does not perform adapter trimming prior to releasing data.
Sequences to trim:
- Read 1: AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
- Read 2: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
The sequences are from page 16 of Illumina's adapter seq document.
- What sequencing instrument should I select?
The default instrument for Illumina sequencing is the NovaSeq6000. We also have a MiSeq for small projects which require low data output and 250bp or 300bp readlengths.
- How is data delivered?
Data is delivered via email, which will contain a link to download the files. The link will also contain the Ruddle storage paths for individuals who have access to Ruddle. Ruddle access is available to any Yale user.
- How long is the data available?
The data links containing the fastq files are active for 1 year. After 1 year, fastqs are tape archived and can be recovered upon request. Data recovery can take time and it is recommended to look at the data as soon as possible.